Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12008B3
Clone ID IST12008B3
Vector VICTR76
Project tigm

Sequence tag IST12008B3HMF1
Sequence
CTCCCCATATGCAATTATCTGTAGGCTGTACCTTGTGTTAGGGCTCCATCCAGGCTGTTTTCTCTGCCGAATGTTAAGAA
GACAATACCGCAAAAAAGTGTCATGGCAATCATGTATTTAAATATGTATTTACTTAAAACTTTACTCTGTACGTGTTACG
CCATGAATAGAACAGTGTACCTAAATGTTACCTCCATTCTCTACAACCAGCGGAGTCCAGCTGGACGAAGGGCTTACACT
TAAATATATGAATATATTAAACAGTTAGGCTGTAATTCTTTAAGCTAAACAGCTAGAATGAAATGTCAGGAATTCATCGG
CTCATAAACAGCAGAACTCGCTGTTTCTGTANCCAGTGGAA
Sequence Type genomic DNA
Unitrap ID UNI12993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35166232..35166591 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043681 (2200001I15Rik) NM_183278 RIKEN cDNA 2200001I15 gene Gene [Source:MGI Symbol;Acc:MGI:1916384]

 
Come back to gene ENSMUSG00000043681


For any suggestions or comments, please send an email to unitrap@crg.es