Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0348
Clone ID CC0348
Vector pGT0lxfT2
Project sanger

Sequence tag CC0348
Sequence
GGGGGGGGGAGCTTTTAAAAGGGGTTTTTTTTTTTTTTTATAGGTAGCCGCTGCGGTCCAAGGAGAGGAGTGTCTTGGAC
TAGTCCGCTGGCAGATAGAGGCGGCCTTCTCGAGTCGTGTCAAGGCTAGGACGCGACGCCCTCTACGTTCTTAAGGCCTC
AGACTTTCTTCTGCGGCCGGCTGGACTGGATGCTCGAAGGCCTGGGCCTTTCCTACAGCTGAGCCAACGGGAACGCGGAA
CCTCCGTGGATCTGCCAATAGAGAGCGCTCGGCCGTGGGCAGGCGGGGCCTCTGATCCCCGGAGCACCTGGAACCCAGCA
CCTGCGTT
Sequence Type mRNA
Unitrap ID UNI1801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 146037638..146037924 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041775 (Mapk1ip1) NM_027115 mitogen-activated protein kinase 1 interacting protein 1 Gene [Source:MGI (curated);Acc:Mapk1ip1-001]

 
Come back to gene ENSMUSG00000041775


For any suggestions or comments, please send an email to unitrap@crg.es