Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12427B7
Clone ID IST12427B7
Vector VICTR76
Project tigm

Sequence tag IST12427B7BBF1
Sequence
CTCTTCTGGTGTGTCTAAAGACAGCTACAGTGTACTCACAAACA
Sequence Type genomic DNA
Unitrap ID UNI32856

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 113980954..113980997 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042385 (Gzmk) NM_008196 granzyme K Gene [Source:MGI (curated);Acc:Gzmk-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180442962..180443005 44
NO GENE  

 
Come back to gene ENSMUSG00000042385


For any suggestions or comments, please send an email to unitrap@crg.es