Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14629A3
Clone ID IST14629A3
Vector VICTR74
Project tigm

Sequence tag IST14629A3HMR1
Sequence
AGGGAAATTGAAAAACAGAAGGGAAACCACATGCTGCAGGACTGTGAAAGGGCGCTCAGCAGGAAAGGGGCTGCAGTGCC
ATGGGGGAAGGGCAAAGGGGGCGTGCAGCCCANAGCTGCATTCGAAGCACTCATCAATCATTTTACTGGCACCAGGAANC
CAATCAGCCTTTANAAAAGAGAGCTTAATCAGTCACCTAATGTGGGAAAGTACAATTGCTTTCTCCCCAAATATTCCCTT
TCTTGCTGATAANCTAAAATCTNAAAGATAGTTGGGGTGGGTGATAGTCAGGATTCAATCNTGTAAGTTACTGANNTACT
GTGATGAAGTTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI15829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38770427..38770761 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]


Sequence tag IST14629A3HMF1
Sequence
CCCTTAATGAATTAATGTTCTCAAATGCAAGGCACTTGATCTTCAGAAGTTGGCACTCTTCTCAAGGCTCAAGGAGTTTT
ACAGTTAAAAATCCCTTCACACGCAAAGAGCAAAAGCTCTGAAATTAACTATGGACTTGGCTTAGTAAATAAAGCTGTAC
TCACAAAAGAGAAAGTGTGACAAAAACAGGTTACAAATGGGAAGAAAAGTGATCCTGTTTTAAAAGAAATATTGAATTTC
TCTCAAATTACACTACAAATCACTCTAACATTAGCATTCTAATAGTAACCAGAAAGGTGACTTATACAGGAATTTGCATA
TAAGTGTCAGGACACTGCACTTTTTANAAACCAGGCCTACTANTATAAAAACAGACNACGTGTATGTAAGANCGATTANA
TANTATCTGNNNTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38770758..38771166 397
NO GENE  

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es