Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A061E06
Clone ID A061E06
Vector pT1betageo
Project ggtc

Sequence tag A061E06
Sequence
GNGCCCCCCGGACCCGAGATGCCTAANNNNGNNAAAAAGGGAGGCCACAAAGGCCGATNNANNNAGTATNNNGGCCCGGA
GGAGATCGATGCCCANNNACAGGCTGAGNNNNCAGAAGGCCAACGAAGAAGATGAACAAGAAGAAGGTGGAGATGGGGCT
TCAGGTGACCCAAAAAAGGAAAAGAAATCTCTAGACTCAGATGAAAGTGAAGATGAAGATGATGACTACCAGCAAAAGCG
AAAAGGCGTGGAGGGGCTCATTGACATTGAGAACCCCAACCGCGTGGCACAGACAACTAAGAAGGTCACGCAACTGGATC
TGGACGGGCCAAAGGAGCTTTCAAGGAGAGAAAGAGAAGAAATAGAGAAGCAAAAAGCAAAAGAACGCTACATGAAGATG
CATTTGGCTGGGAAGACAGAGCAGGCCAAGGCTGATCTCGCCCGGCTGGCAATCATCCGGAAACAGCGGGAGGAGGCAGC
AAGAAAGAAAGAGGAAGAAAGGAAAG
Sequence Type mRNA
Unitrap ID UNI12117

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 145892234..145900862 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029623 (Pdap1) NM_001033313 PDGFA associated protein 1 Gene [Source:MGI (curated);Acc:Pdap1-001]

 
Come back to gene ENSMUSG00000029623


For any suggestions or comments, please send an email to unitrap@crg.es