Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14746D12
Clone ID IST14746D12
Vector VICTR76
Project tigm

Sequence tag IST14746D12HMF1
Sequence
CTGTGACCCCTGGAGGACACTCATAGCTGCTGCCTGGACTACAGCAGACACTGGCCCAGGGCCCCCATTTGCAGAGGGCT
CTGAGCCAAGGACAGGAAGCATCAAATTCACACAGCAAAAGTCCATCTTTGTATCTCGGGGGCGTAGACGGAGTTACCCC
TGGCCGACGCCCCTGAAACAGAACTAACTAAACTGTGGGGATCTGCTTTCCTGCCTATTACTTCCTGGGTATCTGGCCCC
TGCTGTGCTGTGGAAACCGCTTCTTTATGGCATCTTGTACATTTGGAGAGATGAGTTTTGTAGGCATCCAAGGAACTGGA
TAGCAATTGATGCACGGGCCCTTTGCCTAGAATGAGAGAACAGTGAGTGTTTTGGANGGAANTCCGGCNAATATGAACCA
CATTTACTCAAGTGATTNNAANCAGGGAAAAGCGCGTCCCCTCCNCTCTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI32859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11260583..11261035 439
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]


Sequence tag IST14746D12HMR1
Sequence
TTGGGTTGTAAATCCNTNACTAGGCATGGCCTGAGCAGCCTTCTTGGGAACGATTTATTTGAATCCTTCTTCATTACGAT
TCAAATAGAATAAGGAAGGTAAAAATTGAACAGACCCAGAAATTGTGCCTTCCTGCTCCCTCAGTCANTAAACATTTATT
CACTAAACTGAGCGCGCGCGCCCCTGGCTTCTCTCTCCCGGTCTTGGCTCACCCACACTTGTTCCTCCANTCCTTCCTGC
ATACTGTTTTAATGCATAATTAAGAAGGTCANAATTAATGAAGCCGTGCGGAGTAAAGTTCAAGGAATCCCCAGGTACTA
TTTATTCTATTANATCTCANGCGTGAATGTCAGATTGGCAGCATTAGCTGCAGGGTCTTTGGCCCTGGCTACATCCNANG
GACCNCCCACCCANGGAGACTCACTTGAACCGTCNNGTGATTCAGAAGCTCCNTCCCNGCNAAAATCNCACGCANCTGGT
CAGCTGNNACCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023826


For any suggestions or comments, please send an email to unitrap@crg.es