Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14956H5
Clone ID IST14956H5
Vector VICTR76
Project tigm

Sequence tag IST14956H5HMF1
Sequence
GAATTGAGTCNGGATGTACTTGCCAACAGCCCCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148216147..148216182 34
NO GENE  


Sequence tag IST14956H5HMR1
Sequence
CATTGCTACTGACGATCCAGTGTTCTGAGAANAANCAACCCATCTGGAGAGAAAGTGGGATCGTTTGGTTTTTGGTTTTG
GGTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI24796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5765347..5765453 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039128 (Cdc123) NM_133837 cell division cycle 123 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Cdc123-001]


Sequence tag IST14956H5BBF2
Sequence
AATGCAACCTATACACACTACCAAACTGGAGCTTCATCCAGACTTGGAGGTACCGTCTGTATCACTGTTCTCATTGTACA
ATGATGGAACGCAACTCTCACCAGAGGGGGTTGTCGGTCAGCAGCAGGCAAAGTCTCCAGTTTTGTTTTGTTTATTGCCT
TGCGCTTCTGACAATTCCCAAAGTATCTATTTCAATCTACCCTACCGAGGACCCCCACCGCCTCCCTACCTCCCTCGACT
CGCTCTTTGATTCCGAACAGGACGCACGGCAAACACTGATCTACTTGTTAATCTTGCTCCGTCAAAGCCAATANAAAATC
CGCANCTCGACACANTCNCTCCCACTGANTANAAGGCCTGCGGANTTTGTTTANTTTTCTGAANGGATGGGATTTACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5765450..5765848 381
 
EST/CDNA Est Name
  BX525831.1 - BF467977.1 - BG802797.1 - BU922782.1 - BU922795.1 - BU922602.1 - CB950766.1 - BG805622.1 - BG089051.1 - BF471917.1 - CK624944.1 - BQ964529.1 - BI081961.1 - CK392946.1 - BG800514.1 - CB055923.1 - CA529486.1 - BU846831.1 - CA465438.1 - CB952914

 
Come back to gene BX525831.1 - BF467977.1 - BG802797.1 - BU922782.1 - BU922795.1 - BU922602.1 - CB950766.1 - BG805622.1 - BG089051.1 - BF471917.1 - CK624944.1 - BQ964529.1 - BI081961.1 - CK392946.1 - BG800514.1 - CB055923.1 - CA529486.1 - BU846831.1 - CA465438.1 - CB952914


For any suggestions or comments, please send an email to unitrap@crg.es