Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14186H11
Clone ID IST14186H11
Vector VICTR74
Project tigm

Sequence tag IST14186H11HMR1
Sequence
CTCTNATGCGATTGGTTTTTATAAAATATTTGGGGGTGAGGGTGTCCACACAGGATTTCTCTGTGCAATANCTCTGGCTG
TCCTAAAACTCTCTGGAGACCNGACTGGCGAGATCCACCTGCTTCTGTCTCCTGAGCGCTGGGATTAAAGGTGTGTGCCA
CCATCGCCTGGCAACAGTTTTGTTTTTAATGAAATGAGTTTTANTT
Sequence Type genomic DNA
Unitrap ID UNI17399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147582413..147582618 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029640 (Usp12) NM_011669 ubiquitin specific peptidase 12 Gene [Source:MGI (curated);Acc:Usp12-001]


Sequence tag IST14186H11BBF1
Sequence
NGAGGANGAAGCCCNATGGAANGACANNCNNCGGGCACGCTANAGCANGACTGTGAANCTGCNNCCCGAGTCTGCTNTGG
GCCACAGCATTAANTGGTTGANCGGTGCNTCNCNGCCNNNACNTGGNTTTCCTGANGAACNNAACCCNTGCCNCTGTGCC
CTCTTTCCNNCTACAANTANGTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029640


For any suggestions or comments, please send an email to unitrap@crg.es