Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10115B5
Clone ID IST10115B5
Vector VICTR76
Project tigm

Sequence tag IST10115B5HMF1
Sequence
NANCCNNCNGAGATCCCCAGGATGAGGTCGGGGTCTCACCGCGCTCTGTCTGCAGGTTCACATTCCTTGCGGTATTTGGT
AACCACGACCGTGTCTGGACCAGGTCTTCGAGATTCCCATGTCTTCATTGTTGGCTACATGAACTACATGCAGTTTATGC
GCTTTGACAGTGATGGAACTACTCAGAGGATCCAGGCGCGAGGGCCCTGGGTGAAGCAGATGGGGCCTGTGTNTTTGGAG
ATGGAAAGAAGGAAAATGGAGAGCTATTCACACAGGGCCCGAGAAAACCTGCGATTCGCAATCCAGGTCTACAACCNGAG
CGACAAGGGTGAGTGACCCCTTCACATCTCCACAGACCNATCTAANTCGCCCAGGGTCCCANACCNTANGTTTGGCNNGA
NGGTGGGGAATTTGCANAGACCGGGAACCCAAGAGAATAGTGGANGGAGGGCTGGTTTCCAGTGTAGGTGAAAATTCCAT
GGGTGGGCGGNGCTGANTTTGAGA
Sequence Type genomic DNA
Unitrap ID UNI32335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107611..37108104 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  


Sequence tag IST10115B5BBR1
Sequence
GTTCCTCGGGTCAAGAGGGGTTCAGGGCACCGGACTCCGAACATAGGATAGAAAAGGGAACTGGAGAGTGTTGCTGGGCG
ATGAGAAGGAGCAGCTTCCCGAGTGTTGTCCGGAGCTGTTTCCCTCCAGACCCACACTAACCATAACCAGCAAAGCTCTG
GTTCTTGGTCTGGATCAGAGCCAGGAATGCTGAGAGCAGCAGGAGGGTGGCACAGGGTGCTGTAGGCCCCATCCTTGATG
TGTGGAAAGTCTGGAGGGACTGAGACTTTGTTCCTCTCTGTGGAGTTTCTAGCACTGTGGGTTGTGGGAAGAACCACAGT
GACTGTGAATAGTTCTCTAAAATTCCTACATGCACTGGGAGTGAGAACATGGGTCCAGATGGAAGAACAGCGCAACTGAC
ACAGTTTGTAAGCTACCCAGAGAGAATTCAGAAGGGACAAGGGACTTCCCAACCCATGGCTTCCCCACCACAGACACCTT
GAAGACAAAAAACCTCACACTGGGGACTTAGGAAAGCCCACTTCCTCCTGTACTTGGTGCTCTTTGACACATCTGCTCTC
TCTGAGTCCTGTTAAAGGACCTTTGTCCTATGAGATTCTCAGTGTTAGAATTCAGATCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37108110..37108727 608
 
EST/CDNA Est Name
  EH096046.1

 
Come back to gene EH096046.1


For any suggestions or comments, please send an email to unitrap@crg.es