Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11653H12
Clone ID IST11653H12
Vector VICTR76
Project tigm

Sequence tag IST11653H12BBF1
Sequence
TAAGAAGTTAGAGTTNAAATCCCTGTAACCACATGGCGGCTCACAACCATCCGCAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155046323..155046387 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]


Sequence tag IST11653H12HMR1
Sequence
CANGATGCACTTGAACTCANAGATCCAACTGCCTCTGACTCCAAAGTGTTGGGATTAAGGGTGAACACCACCNCCTGGCC
NNCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155046166..155046245 74
NO GENE  

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es