Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14785D8
Clone ID IST14785D8
Vector VICTR76
Project tigm

Sequence tag IST14785D8HMF1
Sequence
CTCCCAAGTGGAAGATTACTGCATGAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14785D8HMR1
Sequence
GGAGGATGAGGCAGGAGGATTGATTGTTTGAGGCCNTCTGGGGTACAGGAGACCTGGTCTCAAGAAAGCAAACCAAAAGC
AGTGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114418423..114418508 84
NO GENE  


Sequence tag IST14785D8BBF1
Sequence
CTCCCAAGTGGAAGATTACTGCATGAGTTAACAGGTGCAGCTTTTACTTGTTTTATTATCAAAGATAACAAACAGGCTGG
CGAGATGGCTCAGTGGTTAAGAGCGCTGACTGCTCTTCTGAAGATCCCAAGTTCAAATCCCAGCAACCACATGGTGGCTC
ACAACCATCCGTAATGAAATCTGATGCCCTCTTCTGGAGTGTCTGAGGACAGCTACAGTGTACTTATATATAATAAATAA
ATAAATAAATCTTAAAAAAAGAAAAAAAAANAACANATTATCTTTAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114418132..114418426 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es