Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11636C12
Clone ID IST11636C12
Vector VICTR76
Project tigm

Sequence tag IST11636C12BBF1
Sequence
GGTAAGAGCACCCGACTGCTCTTCTGAAGGTCAGGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCGTAA
TGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI14763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89775340..89775428 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134662685..134662773 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58424275..58424363 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98522938..98523026 87
NO GENE  


Sequence tag IST11636C12HMF2
Sequence
NGTAANANCACCCGACTGCTCTTNTGAANGTCAGGAGTTCAAATCCCANCAACCNCNTGGTGGCTCACAACCATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es