Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10890F4
Clone ID IST10890F4
Vector VICTR76
Project tigm

Sequence tag IST10890F4HMR1
Sequence
CAGAATCTTGTCCCCTGCCTATGCAACCTNNGGAGCCTGGGGGAAGGACTCTGCATCAGGTATCCAGGTAGCATCCTAAT
CCAGGATCTAGGATTCACCTTACTGTGTAGAGACCTCTTACCCACATAAGATTAGAAGTTTCCGTTTGCGTGTATTGGAA
GTTAGAGTTAANACTTAAACACAGTTTTATGGGGAGGACTGTAATGCANTCTACTACNGATGAAGTGGTTGTTNTGNNNG
N
Sequence Type genomic DNA
Unitrap ID UNI11698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123376296..123376531 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]


Sequence tag IST10890F4HMF1
Sequence
CTGTGATCACACTGGAAGCCAGCCAGCCCCCCTGGGCACTTACTTNCTGCCTTATAGCTCCCCTCTGANGAGAAGCCTCC
TTTGAAGTAGGCAAGAAGGTTTTACAGAGTCAACG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123376529..123376642 110
NO GENE  

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es