Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10072A3
Clone ID IST10072A3
Vector VICTR75
Project tigm

Sequence tag IST10072A3HMF1
Sequence
TTATCATTTCTGTTCCTACCTTTTAAAATTATAATTCACAAGTTATTTTCATGTCCAACATACTAGATAATATTTATAAT
TTAAAAAGTAACCTCAAGTAAATTTTGGAGCATTTCACTGCATTTAACACCATACAGTTGGCTAGGATGAGGTAGGTATG
TATTCACTGTTTCACACGGCCCATTAATCAGAAAAGAGGGAAGGTAAAGTGTGATCTTATTATCATCTTCTCTGTGTAAA
GGAGGAAAGGATCAATATATCCAGGGTATTAAAATTTANGTNTGTGTGAGTTTTGTATCANACAGAATGTAATTAATCAG
ACATATAAACAAACACAAAGTTATTACACNTTANNCGTANGTCCAGATGGTTNANATTTTGGANGTTGGNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17855182..17855573 370
 
EST/CDNA Est Name
  CB317459.1 - BI792543.1 - CF585616.1


Sequence tag IST10072A3HMR1
Sequence
NAAAAATGTTAAAATTATGAAAAATGGCATTGTCTTTTGATAGCTNGTAACTTGATTTTATTTAACTGTCTAATAGGAGA
AATGGTAGCCTTAAAGAAAGTACGTCTGGATAATGAAAAGGAGGGTTTCCCAATTACAGCAATTAGAGAAATTAAAATTC
TTCGGCAACTCACCCACCAGAGTATCATCAATATGAAGGAAATCGTGACTGATAAAGAAGATGCTTTGGATTTTAAGAAA
GACAANGGTATGTATGCAGACTTCCTAACCAAGTCTTTGAATTCATGTTATTTCNNACTGGATAATTATTTAAGGACTGG
GTAGATAANATGTTTTCTAATGTCC
Sequence Type genomic DNA
Unitrap ID UNI32863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17854841..17855183 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041297 (Cdc2l5) NM_001081058 cell division cycle 2-like 5 (cholinesterase-related cell division controller) Gene [Source:MGI Symbol;Acc:MGI:1916812]


Sequence tag IST10072A3BBF1
Sequence
TTATCATTTCTGTTCCTACCTTTTAAAATTATAATTCACAAGTTATTTTCATGTCCAACATACTAGATAATATTTATAAT
TTAAAAAGTAACCTCAAGTAAATTTTGGAGCATTTCACTGCATTTAACACCATACAGTTGGCTAGGATGAGGTAGGTATG
TATTCACTGTTTCACACGGCCCATTAATCAAAAAAGAGGGAAGGTAAAGTGTGATCTTATTANNANCNTCTCTGTGTNNA
NGANGAAAGGATNNATATATCCNNGGTATTAAAATTNANGTATGTGNNANTTTTGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041297


For any suggestions or comments, please send an email to unitrap@crg.es