Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14971H8
Clone ID IST14971H8
Vector VICTR76
Project tigm

Sequence tag IST14971H8HMR1
Sequence
NTATCATCCAGTGGATTTGGGTTGCTGATGGTAGGAATTTGATTTGCCATCTTGCATGCTTGCATGTACCTTATTGCCNG
ATGCAGAGATGTCCTGTGTTGGGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI11042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18288599..18288705 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]

 
Come back to gene ENSMUSG00000022718


For any suggestions or comments, please send an email to unitrap@crg.es