Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12787F12
Clone ID IST12787F12
Vector VICTR76
Project tigm

Sequence tag IST12787F12BBF1
Sequence
TTAGGAGCTATGCCCGTTGGCCGTCTCTGACCTTCTGTGTGCTTAAGTTAGCAGACAGCAGGGTCTCTGCTCTGCATATC
CACAAGGTGCAGATAGAGAGGCCTGACTCACCCAGTTGCCACAGTAGAGCAGAGGCTGAAAGTCAGACAGGGGCTCCTTC
AAAAGTGGGAGGTGCAGCCACCTCTAGCCCANCAGGAGTGTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI28593

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50205002..50205206 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020375 (Rufy1) NM_172557 RUN and FYVE domain containing 1 Gene [Source:MGI (curated);Acc:Rufy1-001]

 
Come back to gene ENSMUSG00000020375


For any suggestions or comments, please send an email to unitrap@crg.es