Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A055B01
Clone ID A055B01
Vector pT1betageo
Project ggtc

Sequence tag A055B01
Sequence
ANNNNGGCAANAAAANATTTTCCGGGAAGGGGGGCGGTCCCTTCTCCAGCAAAAAAGTGGTAAAANNNAACATTCAGTGT
GTTTCCTGTACCAAATCCTTCAAGAAACTNNGGTCCCTTCATGACCATATCAAGATGGTCCATGGATATGCAGAAAAAAA
ATTTGCCTGTGAAATTTGCGAGAAGAAGTTCTATACCATGGCTCATGTACGAAAACACATGGTTGCACACACAAAAGACA
TGCCATTTACATGTGAGACCTGTGGAAAGTCTTTCAAGCGCAGTATGTCACTCAAGGTGCACTCCTTGCAGCATTCTGGA
GAGAAACCCTTCAGATGTGAGAACTGCGATGAGAGGTTCCAGTACAAGTACCAGCTCCGCTCCCACATGAGCATCCACAT
TGGGCACAAGCAGTTCATGTGCCAGTGGTGTGGCAAGGACTTCAACATGAAGCAGTACTTCGACGAGCACATGAAGACGC
ACACTG
Sequence Type mRNA
Unitrap ID UNI12124

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95614187..95615369 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075595 (Zfp652) NM_201609 zinc finger protein 652 Gene [Source:MGI (curated);Acc:Zfp652-001]

 
Come back to gene ENSMUSG00000075595


For any suggestions or comments, please send an email to unitrap@crg.es