Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14765A12
Clone ID IST14765A12
Vector VICTR76
Project tigm

Sequence tag IST14765A12HMR1
Sequence
ACTGGAGAAGGATGCTAAAAATTGAATTCAGATCTTCTCTGCAAGAGCAGAGATGTGCTCTTAACCACTAAGTCATCTTT
CCNGTCCCAAATGTTTAAAATGTATTTCTGTTGTGGTATTCCCTTATATACACTCAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI18850

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69473925..69474064 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018761 (Mpdu1) NM_011900 mannose-P-dolichol utilization defect 1 Gene [Source:MGI (curated);Acc:Mpdu1-001]

 
Come back to gene ENSMUSG00000018761


For any suggestions or comments, please send an email to unitrap@crg.es