Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14814C8
Clone ID IST14814C8
Vector VICTR76
Project tigm

Sequence tag IST14814C8HMF1
Sequence
ATTTTATAGATAATTATTAAAATTCTTTATATAAAAGAAATTTTTAATTGAGGCTGGCTTACAGTTTAACAGATTTAGTC
CATTATCATGATGGTGGGGAGCATGGTGGAATGCATGGTCCACATTGTTATGAAATAAAACGTGGCACTGGGTAGGGGGT
ACCTGGCAGGCCCATGCCAAGGTCTGTCTGAGGAATCACACCATGATACAGACCTGATTTAAGGGAAATTTACTGGGGGT
GGGGGGGCANAGGCAAGCNGGACCTGGAAAAGGGCTCAATACAAAGAAAGTANGGACAGAAAGGTGCNGANAGANAAANA
NGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI32092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57006870..57007195 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]


Sequence tag IST14814C8HMR1
Sequence
TGAAACAAAAATATCCNGTAAATCTTAGTGCAGGTGGCAAGAGGATACAGCTCCCTTCCTCTATTAAAAATGCCAGTGAA
GTTGTAATATTAAAGGTTGAAGTTCAAGATATGCTATTTCGCTAAAACCAGATACATGTAAAATAGCCCTGGGTCTGGAA
TGGATCTGAGCTGGTGTGGTCCTTTACAGCCCTGAGCANTCTGTCNNTANCTCTTTCAAGGAGAAGGGGATGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 38809505..38809736 222
NO GENE  


Sequence tag IST14814C8BBF2
Sequence
CAATCAACTCATAATCTTATTGAAAGGATATATTCTTAGCAATAATATTCATGAAGTCATGGTACTGGATATTATGTGGG
TTTTTTTTTCCNCNAATGCCNCANCAAAATGAACAAAACATTCNTGGTTAAAACAAAAATATTCCTATTGTTGAGGAAAA
AAAATCANANTGGGACCTTTGACAANNAGGCCCTATTTGTANANACCACATTCCATCNAAACTATCACCTGTGTCTGGTN
TCNTTTCAAAAANACTCTCACATCTGTGATTCNGTGTGGTGAANCCNNGANAATTAAGGTCAAANTCTACCNTGACNGGA
NANCTTCTCAAANCTCACTGCNAAATGAAAAAATCCCTTCACCANTNGGACTTCNNNTTNNNTGCTCTTGTCNGANGAAC
CCANNCCCNNACNAACACCCTCCAAGCTGGGGAAGGTCNAGTGNTCCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es