Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13361B7
Clone ID IST13361B7
Vector VICTR74
Project tigm

Sequence tag IST13361B7BBF1
Sequence
NATTGCTGGCTTTCTTTGGCTCTGACCTTTACTAATGTCTAATTTCTTTTCTTTCTGATATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI21437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48831033..48831100 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]


Sequence tag IST13361B7HMF1
Sequence
TAATAAATAGTTGTCCNAAATATCCTTCCGCTTATCTCTCTCCNAGAAACCCATCACCTACCTCAGNNACATTATTGTAA
TTTTAAGAATCCAANGTNNNTAATCACGACTAACAGCTCNCTTTATAGAATTTAATCCTCTTTTACACTTTAGGGANNAC
TTTTTAGGGACAGACCATTTTTGCATAAGTTGAAAACGGNTTATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es