Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15000D8
Clone ID IST15000D8
Vector VICTR78
Project tigm

Sequence tag IST15000D8HMR1
Sequence
TGCTGAGATGAGAGCTGTGTGCCACAAAGCTCTGCTCCGATGTTTCTTTCTTTCTTTTTCTTTTTCTTTTTTTTTGGTTT
TTCAANACAGGGTTTCTCTGTGTANCCCTGGCTGTCCTGGAACTCACTCTGTANACCNNTCTGGCCTTGAATTTAAAAAT
CCTCCTGCCTCTGCCTCCTGAGTGCTGGGATTAAAGGCGTGCGCNNNNNNNCCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI30552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163496438..163496641 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035268 (Pkig) NM_001039390 protein kinase inhibitor, gamma Gene [Source:MGI (curated);Acc:Pkig-001]

 
Come back to gene ENSMUSG00000035268


For any suggestions or comments, please send an email to unitrap@crg.es