Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12751B10
Clone ID IST12751B10
Vector VICTR76
Project tigm

Sequence tag IST12751B10HMF1
Sequence
GTAGCAGGAAGCTGTCTTCTGTTGAAGTGAGATGTGGTCTAGGTTAGGAACCAGGTGAGGCAGAATCTANTANTATATTC
AGGTAAATTTTATGGATAGGACAGGAAGCATCAAGGGGGCTAAGTATTTATAGCTCAGTTA
Sequence Type genomic DNA
Unitrap ID UNI17993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4832696..4832835 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]


Sequence tag IST12751B10BBF1
Sequence
GTAGCAGGAAGCTGTCTTCTGTTGAAGTGAGATGTGGTCTAGGTTAGGAACCAGGTGAGGCAGAATCTAGTAGTATATTC
AGGTAAATTTTATGGATAGGACAGGAAGCATCAAGGGGGCTAAGTATTTATAGCTCAGTTGACCAGGAAATATGCTGCTA
TAAAGTANGTATAAAGAAGAGTTAACTGTAACGAAAAGGTGAGGTTGAAGGGTAANGGGAATGANNNGANNTNANGACNT
NNNCT
Sequence Type genomic DNA
Unitrap ID UNI17993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4832696..4832919 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es