Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14592C6
Clone ID IST14592C6
Vector VICTR74
Project tigm

Sequence tag IST14592C6BBF1
Sequence
CTATTGCCNAGGTTANCCTCAAAAATCTGCCTCTCANATATGGCAATTATAAGCACATGCTACCACTCCCAACTTCGATT
TGTTGTTGTTGTTTTTGTTTTTGTTTTGGTTTTGTTTTGTTTTGTTTTGTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI13035

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35963193..35963337 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]


Sequence tag IST14592C6HMF1
Sequence
CTATTGCCAAGGTTAGCCTCAAAAATCTGCCTCTCAAATATGGCAATTATAAGCACATGCTACCACTCCCAACTTCGATT
TGTTGTTGTTGTTTTTGTTTTTGTTTTGGTTTTGTTTTGTTTTGTTTTGTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI13035

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35963193..35963336 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]


Sequence tag IST14592C6HMR1
Sequence
ATAGGAGAGCCTGTCTCAAAATAAATAAATACATAAAATAGAGGGATATCTAGAAAGAGCTAGGGAGAGAATTAGGATTC
ATTGTATGGAATTCTCAAAGAATTAATTAAAATATTCATTTTTTTTAAAGTAGCAAACCTGTANCCAGTTACGCAAAACG
TTTCACAGAAAAGCAAACTTTATGGCTTGCATCTATGTGAAAAAAATGTTTATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35962981..35963196 214
NO GENE  

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es