Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12893H8
Clone ID IST12893H8
Vector VICTR76
Project tigm

Sequence tag IST12893H8HMF2
Sequence
TNTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTT
TCTTACTTTCTTTCTTTCTTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI12869 UNI29742 UNI32869 UNI32870 UNI32871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 128389870..128389972 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049690 (E030049G20Rik) NM_001081756 RIKEN cDNA E030049G20 gene Gene [Source:MGI Symbol;Acc:MGI:2686394]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 53023502..53023604 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038594 (AC153524.3-201) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3V3K0]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 18610338..18610440 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 10847353..10847455 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 23509296..23509398 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 93201894..93201996 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 61592945..61593047 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 29303956..29304058 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048939 (Atp13a5) NM_175650 ATPase type 13A5 Gene [Source:MGI Symbol;Acc:MGI:2444068]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 41639778..41639880 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 50133619..50133721 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21992536..21992638 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5618742..5618844 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039145 (Camk1d) NM_177343 calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI (curated);Acc:Camk1d-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8881785..8881887 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040269 (Mrps28) NM_025434 mitochondrial ribosomal protein S28 Gene [Source:MGI (curated);Acc:Mrps28-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15780231..15780333 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88834179..88834281 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3124280..3124382 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11035574..11035676 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34831073..34831175 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3984059..3984161 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161868: 434518..434620 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165791: 228136..228238 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165792: 442113..442215 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166349: 121282..121384 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166354: 30575..30677 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 184296..184398 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166377: 397453..397555 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166380: 168268..168370 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 38774817..38774919 101
NO GENE  

 
Come back to gene ENSMUSG00000040269


For any suggestions or comments, please send an email to unitrap@crg.es