Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12521A4
Clone ID IST12521A4
Vector VICTR76
Project tigm

Sequence tag IST12521A4HMF1
Sequence
CCATCTCTACTTCTAATTGCCTTGAAGGTGTCGTGAGAAACTTCCTGAAGCTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI31057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61971785..61971842 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020077 (Srgn) NM_011157 serglycin Gene [Source:MGI (curated);Acc:Srgn]

 
Come back to gene ENSMUSG00000020077


For any suggestions or comments, please send an email to unitrap@crg.es