Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14351A3
Clone ID IST14351A3
Vector VICTR74
Project tigm

Sequence tag IST14351A3BBF1
Sequence
AAACCAAAATGTCAAAATTGTCACTACAGAGTAGAAGCCCTGTGTCCAGCCTAAGGACTCCTTTTTTAAGCTACTTTTGA
CCATTCAACTCATGGTGATAGAGTGGGGCAGATTAAGTGAGAACACAGTAGACAACTGAGAATGTTTAAGCGTTAACTCT
ATGGCAAATGATGCTACCACGTNAATACTGACATTCTTANATACCATANCTATAATCCTGCAGAATAGTCTTATAATTGG
GAGACGCATGTTTGAAAATGGGGGAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21144325..21144591 261
 
EST/CDNA Est Name
  AA990349.1 - AA028210.1 - AA021806.1


Sequence tag IST14351A3HMR1
Sequence
GGTTTCTTTAGAAAACACAGAAATATTACAAGAATATGTCTTTATTTTAATCCCAGGTATGGGATATGGACCTGCTTCAG
ATTGTCCTCAGCAGCTGGCTATGATTTGCCTCATGCCCTANCAGGGGCGTAATTTTTCCAGTGGCAGACAGTGTCTACAG
TCGTGTGACATTTGGAATTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21144587..21144770 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


Sequence tag IST14351A3HMF1
Sequence
AAACCAAAATGTCAAAATTGTCACTACAGAGTAGAAGCCCTGTGTCCAGCCTAAGGACTCCTTTTTTAAGCTACTTTTGA
CCATTCAACTCATGGTGATAGAGTGGGGCAGATTAAGTGAGAACACAGTAGACAACTGAGAATGTTTAAGCGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21144438..21144591 154
NO GENE  

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es