Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12304B8
Clone ID IST12304B8
Vector VICTR76
Project tigm

Sequence tag IST12304B8BBF1
Sequence
ACACGAGCAAGCGAGCGAGCGCTGGTCTGCTGGAGGTAGAGGTCGGAGGACAGCCTCTGCCGTGGGTCTTTTACCCTTCC
CCTTGCTTGAAACACGTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTGTTTGTTTGCCGCTGTACAG
CCAGAATAATTGAGCCACAAGCCCCTGGGGATGTTCTCTGGAGCTCCTGTCTCACCTCANAAACGCTGGGGTTCCACAGG
CAGGTGTTACCCTACCCAGCCTTATGCAGCTGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI25496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88293413..88293690 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]


Sequence tag IST12304B8HMF1
Sequence
ACACGAGCAAGCGAGCGAGCGCTGGTCTGCTGGAGGTAGAGGTCGGAGGACAGCCTCTGCCGTGGGTCTTTTACCCTTCC
CCTTGCTTGAAACACGTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTGTTTGTTTGCCGCTGTACAG
CCAGAATAATTGANCCACAAGCCCCTGGGGATGTTCTCTGGAGCTCCTGTCTCACCTCANAAACGCTGGGGTTCCACAGG
CAGGTGTTACCCTACCCAGCCTTATGCANCTGGGGATCCACACTCAGGTCTTCATGTTTGTGTGNAANTTCCNGACCCAN
GACCAN
Sequence Type genomic DNA
Unitrap ID UNI25496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88293366..88293690 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es