Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A035C06
Clone ID A035C06
Vector pT1betageo
Project ggtc

Sequence tag A035C06
Sequence
TTTCTCCATGGAAAATCAGCCAGAGTGGAACCACATCCCCAGAATGAACTGCTCAAGGGGTTAAGGACTGTGGAAGGCAA
CTTACCCTACCACCATCTCCTGCCTGAATCTCCTGAGCCTTCTGCCTCCCATGCTCTGTCAGATGATGAAATGTCTGAGA
AGTCCTTCCTGTCTAGAGACCCGAAGCCAGACAGCGATACTGAGAAGGTACCCAGCAATGGCGAGCCATTTCCTCAA
Sequence Type mRNA
Unitrap ID UNI9710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 69915671..69918422 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039298 (Cdk5rap2) NM_145990 CDK5 regulatory subunit associated protein 2 Gene [Source:MGI (curated);Acc:Cdk5rap2-001]

 
Come back to gene ENSMUSG00000039298


For any suggestions or comments, please send an email to unitrap@crg.es