Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14583D12
Clone ID IST14583D12
Vector VICTR74
Project tigm

Sequence tag IST14583D12HMR1
Sequence
NATCCTGGGNNANTAGCAGCAGATGGTTTATAAATNNCTGTGCCTAATGTAACTACTCTTTAGTATCTGACTTCCTGTAT
TGAGTTTAGCATTAAGTAAACATTANCAAAGAGACTTAATACTTTTTTGGAGTTTAGATCAACTAAGAAAGCTAAAATTC
CAAGGCATCCATAGGCAGGAAAAGAAATTAAACAGGGTATTTATCCTGGCATTAAGTCTTTTGCATTTAAAAGCTTCCTT
TGATAAACTGCTGGANTAACCTTTTCGTACCCACTCTAACACGGATTTTCTTTTN
Sequence Type genomic DNA
Unitrap ID UNI1642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108161899..108162191 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]


Sequence tag IST14583D12HMF3
Sequence
AAGTGTACTAAGGGTCTGTCTGTATTCCAGCCCGAAGGATTAAAGGTATGTGCTAAAAACCTGAGCCACACAACTAGATA
CAGGTATTTTCAGTAAATAACACAATAGCCCTGACCTTCCCATCTCAATCCCAGCAGTTATGTTCTTTGTTTTGTTCTGG
TTTACAGTTTTGTTTGATTGTTCNGATAGATAATGGCCCCCTGCCCTTCTGAAGAATGTCTACAGGGTGCAGGCAAAGGC
CGTGTTTTCAGGTCCTTATGCCTCCTGNCTTCAGGTGGTGGAAGANAACTGTGGGGCTNCAACAATGAAGACNATTGATG
ATGTGCTGGAGAGCACACAGGGAANCAGGGACAGTGAATATGTGCCTTANCTCTGTTTTGNGANGGTTGGACNNNTCCCC
NGGTGTCNTTCNGNCTCCTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14583D12BBF2
Sequence
AAGTGTACTAAGGGNNNGTCTGTATTCCAGCCCGAAGGATTAAAGGTATGTGCTAAAAACCTGAGCCACACAACTAGATA
CAGGTATTTTCAGTAAATAACACAATAGCCCTGACCTTCCCATCTCAATCCCAGCAGTTATGTTCTTTGTTTTGTTCTGG
TTTACAGTTTTGTTTGATTGTTCAGATAGATAATGGCCCCCTGCCCTTCTGAAGAATGTCTACAGGGTGCAGGCAAAGGC
CNTGTTTTCAGGTCCTTATGCCTCCTGCCTTCAGGTGGTGGAANANAACTGTGGGGCTACNACAATGAAGACNATTGATG
ATGTGCTGGANAGCACACAGGGAANCNNGGACAGTGAATATGTNCCTTAACTCTGTTTTGGGANGNTTGGACCANTNCCN
NNGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es