Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14987G3
Clone ID IST14987G3
Vector VICTR76
Project tigm

Sequence tag IST14987G3HMR1
Sequence
CATGAAGCTGCTATTTTGGTGATTATGGTACTTTGCAATTTTATAGAGAGCTGCTATTTTCTTTCTTTTAAAGTAATGCT
TGTTGTTTTGACTGTAAAAGTAATAAATGTTACTTTGGAAAATATAGAGAAGTATAAAGAGTA
Sequence Type genomic DNA
Unitrap ID UNI32878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75198186..75198328 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018809 (Smyd4) NP_001096081 SET and MYND domain containing 4 Gene [Source:MGI (curated);Acc:Smyd4-001]


Sequence tag IST14987G3BBF1
Sequence
CATGGAATAGGAAGTGCATCTCCCTCTCCATCCACAGCAAACCTTCATTTCTTTCTTCTTGAGACAAGGTCTTGTGTAGC
CTANACTGATGTCAAACTCGTTCTAGAGCTCATTTTAAAAGATTTATTTTATTTTTAAAATTATGTGTATGTGTGCATGT
GTTAATGTGGTTGCCTGCAGAGGCCAAAAGAGGGTTTTGGATTCCCTGCAGTAGGGAGACCCACTGCCTGCCATGGTCTC
TGCAAGGGCAGTAAGCACTCGTGAGCCTGAGCATCTTTGCANTCCCTCCTGTCTTATTTTTACCTGTTTTCATTAANCAA
CTTTCNATGGGGTAACATTTANGATGCAAAGGCCATANNNCTGAANCCAAATACTTTCTTACNCCATTACAAANNNNGGC
NNTTACAAGTTTGTANANTGNATGATGTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14987G3HMF1
Sequence
CATGGAATAGGAAGTGCATCTCCCTCTCCATCCACAGCAAACCTTCATTTCTTTCTTCTTGAGACAAGGTCTTGTGTAGC
CTAGACTGATGTCAAACTCGTTCTAGAGCTCATTTTAAAAGATTTATTTTATTTTTAAAATTATGTGTATGTGTGCATGT
GTTAATGTGGTTGCCTGCAGAGGCCAAAAGAGGGTTTTGGATTCCCTGCAGTAGGGAGACCCACTGCCTGCCATGGTCTC
TGCAAGGGCAGTAAGCACTCGTGAGCCTGAGCATCTTTGCAGTCCCTCCTGTCTTATTTTTACCTGTTTTCNTTAANNNN
CTTTCCATGGGGTAACATTTANGATGCAAAGGCCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75197836..75198189 342
 
EST/CDNA Est Name
  BF458734.1 - AW488606.1

 
Come back to gene BF458734.1 - AW488606.1


For any suggestions or comments, please send an email to unitrap@crg.es