Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W251D04
Clone ID W251D04
Vector ROSAbetageo
Project ggtc

Sequence tag W251D04
Sequence
AGAAGTGATGGATATTCTTCACAGAGGAGAATTGGTTGCTGCAATACTCCGCAACGG
Sequence Type mRNA
Unitrap ID UNI12149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22892258..22892312 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036782 (Klhl13) NM_026167 kelch-like 13 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl13-001]

 
Come back to gene ENSMUSG00000036782


For any suggestions or comments, please send an email to unitrap@crg.es