Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11272A4
Clone ID IST11272A4
Vector VICTR76
Project tigm

Sequence tag IST11272A4HMR1
Sequence
NTACTACANAGCAATTGTGATAAAACCTGCATGGTACTGGTACAGCGACAGACAGGTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 65627004..65627060 55
NO GENE  


Sequence tag IST11272A4HMF1
Sequence
GTACAGCTTGGGGTCAGGCATGGTGATTCCACCANANGTTCTTTTATCATTGANAATANCTTTTGCTCTCCTAGGTCTTT
TTGTTATTCCNAATGAATTTGCAAATTGCCCTTTCTAATTCGATGAANAATTTANTTGGAATTTTGATGGGGATTGCATT
GAATCTGTAAATTAATTTTGGCATGATAGCCATTTTTGCTATATTGATCCTGCCNATCCNTGAGCATGGGAGGTCTTTCC
ATCTTCTGANATCTTCTTTGATTTCTTTCTTCANAGACTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11272A4BBF1
Sequence
GTACAGCTTGGGGTCAGGCATGGTGATTCCACCAGANGTTCTTTTATCATTGAGAA
Sequence Type genomic DNA
Unitrap ID UNI32879

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 29627819..29627874 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038658 (C030046E11Rik) NM_001081319 RIKEN cDNA C030046E11 gene Gene [Source:MGI Symbol;Acc:MGI:1924893]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3575377..3575432 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24924916..24924971 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 58895875..58895930 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 66275010..66275065 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 6869537..6869592 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 9642905..9642960 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 27342779..27342834 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6064984..6065039 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 157119383..157119438 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 68932550..68932605 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 13542202..13542257 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 99028517..99028572 52
NO GENE  

 
Come back to gene ENSMUSG00000038658


For any suggestions or comments, please send an email to unitrap@crg.es