Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10877C5
Clone ID IST10877C5
Vector VICTR76
Project tigm

Sequence tag IST10877C5HMR1
Sequence
TCCCTGCACCCTGCAGCCGGACGGATAGCCCTTTCACTCCCCTGGCGACTGTCAGAATGTGCGGGTGGACTCTGAGCTCG
ATGCANAACGGCAGGAGCTGTGTTCTGTCCATCAGTGGCGTCCAGCTCTCTGCCTTCACAGCAGTGACCTGGATTCAGCC
CTGGCACGGTGCCCGCCCCCTACCCCTCANCTTCCCGCGCGGCTTTTCTGCAATCAAGCCCCGCGGGATGCANTTTTTAA
GCTGTCANGATTTATCGATTGTGCCCATGTGAGCTTGCTGTCCTTTCCCAGTACCNNNACCCNAGCTTACNGTTN
Sequence Type genomic DNA
Unitrap ID UNI21102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106073962..106074276 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020257 (Wdr82) NM_029896 WD repeat domain containing 82 Gene [Source:MGI Symbol;Acc:MGI:1924555]

 
Come back to gene ENSMUSG00000020257


For any suggestions or comments, please send an email to unitrap@crg.es