Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14176D5
Clone ID IST14176D5
Vector VICTR74
Project tigm

Sequence tag IST14176D5HMF1
Sequence
GTCCCTTCCAGAATCAAGCTTGCTGGGAAGGGAGGGCTGAGGGTGAGGAGTCTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI20749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89701186..89701244 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027947 (Il6ra) NM_010559 interleukin 6 receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:105304]


Sequence tag IST14176D5HMR1
Sequence
GGACAAAAAGAACCATCTTTGGGCTNAGCCTCCATTTTCTGGATGTCTCGCACTTTTGAAGGTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89701241..89701306 64
NO GENE  


Sequence tag IST14176D5BBF1
Sequence
GTCCCTTCCAGAATCNAGCTTGCTGGGAAGGGAGGGCTGAGGGTGAGGAGTCTGGCCNGTGACAAACAAGAGCTACAAGG
GTGGGGTGGAGACTCTGGTCTGAAAGTGTTTANAAACTTGCCTGTCTTAAGTCCNCCCCATCNCCAGGATTCCATGCACA
CTGCACACCCCCACCCCCTTCACCCCACCCCATGTAATACCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI20749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89701037..89701244 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027947 (Il6ra) NM_010559 interleukin 6 receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:105304]

 
Come back to gene ENSMUSG00000027947


For any suggestions or comments, please send an email to unitrap@crg.es