Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0133
Clone ID CA0133
Vector pGT0lxf*
Project sanger

Sequence tag CA0133
Sequence
CTAGATGGCAGAGTTTTATAGAGAGAACGAAGAGAAGTCAAAGGAGTTAGAAAGGCAGAAACACATGTGCAGCGTGCTGC
AGCATAAGATGGATGAACTCAAAGAAGGCCTTCGGCAGAGGGACGAGCTCATCGAGAAACATGGCTTAGTTATAATCCCA
GACAGCACTCCCAATGGTGATGTCCATCATGAGCCTGTGGTTGGAGCCATTACTGCTGTGTCTCAGGAAGCTGCTCAGGT
CTTGGAGTCAGCAGGAGAAGGGCCACTAGATGTGAGGCTACGAAAGCTTGCTGGAGAAAAGGACGAGCTCTTGTCACAG
Sequence Type mRNA
Unitrap ID UNI1814

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 111102299..111118482 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032497 (Lrrfip2) NM_027742 leucine rich repeat (in FLII) interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1918518]

 
Come back to gene ENSMUSG00000032497


For any suggestions or comments, please send an email to unitrap@crg.es