Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0131
Clone ID CA0131
Vector pGT0lxf*
Project sanger

Sequence tag CA0131
Sequence
ATGCAGAGAAACATCCTCAGCAAGGACAACACAGGCCATGACCTGCGGCAGCAGATGACAGCGCTACAGAGCCAGCTCCA
GCAAGTACAGCTGGAGCGCACAACCCTGACCAGCAAACTACAAGCATCACAGGCTGAGATCACGTCTCTGCAGCATGCCC
GGCAATGGTACCAACAGCAGCTTACTTTGGCCCAGGAGGCCAGGGTCAGGCTGCAAGGAGAGATGGCCCATATCCAGGTT
GGACAAATGACCCAGGCAGGCCNCTTGGAGCACGGGACTTTTGGAGAAGGGGCCCCTTTGGGGGGGGGCCCCCCCAAATG
GGGTAGCTATCCTCCAAGGAGCAAGAGCGCATAGCCGTTCTCCTCCAGGAGCAATCCAG
Sequence Type mRNA
Unitrap ID UNI1815

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110618898..110622770 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029502 (Golga3) NM_008146 golgi autoantigen, golgin subfamily a, 3 Gene [Source:MGI (curated);Acc:Golga3-001]

 
Come back to gene ENSMUSG00000029502


For any suggestions or comments, please send an email to unitrap@crg.es