Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13063E9
Clone ID IST13063E9
Vector VICTR76
Project tigm

Sequence tag IST13063E9BBF1
Sequence
GTAATAGGCTATCAATTAGGGAAGGCGGAAGATCCCGAGATTGCTGGACAGCAATGTGAACATAGCCATGGTGGCTCTTG
CCTTATAAGCCTGGCACTTATGACACTGACGCAATAGTACTAACAAGGCNAGCCTGGGCTACATAGCAAGTTCCAGAACA
GACAAGGCTACCCAGANAGACCCTGTCTCAAAAAAACCATACAAAGGTTAAAGTGGAGAGCTTTANGTTACATATATCTG
GACCTAACTCGCTCACACAAACTACAAGACCNCGAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26652919..26653200 274
NO GENE  


Sequence tag IST13063E9HMR1
Sequence
TTACCNAGTAACCNGCTTTTGCTGTATTATTTTATCTTAAGGCATTTTATTTTGTGTATTTTCATAATGCAAAATAAGGG
ACTTTTTTATTTTTTTAAAGGCAAGGTCTCANATCTTGTTGCATAGTCTGAATGGCCTGGAAATTGCTCTGTATACCAGG
TTTANTTAATCTGCCTGCCTCTGTCTCTGGATGCACTACCCCATACACATACACAGTGCTGGGATTTAAGGTGTGAGTGC
TACTAAAGAGTCACTCCACCCCACCCCACCCTTTTTTTNTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26653197..26653474 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es