Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14955B7
Clone ID IST14955B7
Vector VICTR76
Project tigm

Sequence tag IST14955B7HMR1
Sequence
TGCTCGCTCTAGTCTCTATCTCTTGCTGTTCTCCTTTCTCACAGATAGCCC
Sequence Type genomic DNA
Unitrap ID UNI18529

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5325761..5325811 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]


Sequence tag IST14955B7HMF1
Sequence
CAAGGTGAGACTAGCCAGGGCAGAGAAAACCTTGCCATTATAGAAAGAACAACTGTGTGTAGGCAGAGGGAACCCGGGAA
GACAGCATGCTAGCAGCGTGCTAGTGTGGACTTTGAAATGTAGAACAGGTACTTGGGATATTGAGGGAGCCAGAGGCCTG
CCTGTGCTTTGATATGTAACAAAGGTAGCCATTTGTCCTTCTGCTAGAGGTAAGGGAAATGGTTCCTTCTGTTAGATGGG
GACCAGTTTCATAAGTTCTTGAAGAAGGCTGGCTTTTATATAACCGCCAGACATCATACAGTCTAGCTTGAGCTCATTTC
TGGATATATGGATGTCTTTTGGAGTACAGGGAACTGGGGCTTTTTTCTTTGGACCNGACNACNTGTCCTTANAANNCNNT
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5325369..5325762 386
NO GENE  

 
Come back to gene ENSMUSG00000069729


For any suggestions or comments, please send an email to unitrap@crg.es