Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W245E05
Clone ID W245E05
Vector ROSAbetageo
Project ggtc

Sequence tag W245E05
Sequence
TCCCCNNNGCCTCCACAGGAGCAGGTAATTCACTGGTCCACAAGCGGTCTCCTTTACGTCGAAACCAAAAGACCTCAGCA
TCCTTGAACAAGCTGTCTTTACAGGATGGACATAAAGCCAAAAAACCAGCATGTAAATTTGAAGAGGGTCAAGATGTCTT
AGCTAGATGGTCAGATGGCTTGTTTTATCTTGGAACTATCAAAAAGATAAACATATTGAAACAGAGCTGCTTCATCATAT
TTGAGGACAGTTCCAAATCCTGGGTTCTGTGGAAGGACATCCAAACAG
Sequence Type mRNA
Unitrap ID UNI3145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509847..108510237 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es