Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W235F04
Clone ID W235F04
Vector ROSAbetageo
Project ggtc

Sequence tag W235F04
Sequence
GGCGGCAGCAGTAGCGGGCCCACTCGCCGCCGGGGGTGAGGAANNNGCAGCTTCAGTGTCCTTGCCAGGGTCTCCTGGTC
TACCTGGGAGCCGTAGCGCAGAACGAGCCCTAGAGGAGGCTGTGGCCACCGGGCCCCTGAACTTGTCCAACCGGCGTTTG
AAGCACTTCCCCCGGGGCGCGGCCCGCAGTTACGACTTGTCAGACATCACCCAGGCTG
Sequence Type mRNA
Unitrap ID UNI679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138070437..138070654 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029720 (Lrch4) NM_146164 leucine-rich repeats and calponin homology (CH) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1917193]

 
Come back to gene ENSMUSG00000029720


For any suggestions or comments, please send an email to unitrap@crg.es