Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15061G4
Clone ID IST15061G4
Vector VICTR80
Project tigm

Sequence tag IST15061G4HMF1
Sequence
NCTCCGACATACCTGGCTCCCTTTTCNGNCTCTNACTTTATTCTTAAGATCCCCTCCTCATCCTGCCTTCTGGTTCCAGT
TTTCCGTGCCTCAACTTGCGGGTACCATTGCGCTCTTCCTCTCTTGTGACTGGCTATATCCCACACTACCTGTTTTCTTC
AAATCAAACCCACCCCTGCCCTCACCTCCCTCCACCTTTTCCTGCAGATGTGGACGAATGCCAACTCTTCCAGGACCAGG
TGTGCAAGAGCGGAGTGTGTGTGAACACGGCCCCAGGCTACTCTTGCTATTGCAGCAACGGGTTCTACTATCACGCACAC
AGGCTGGAGTGCGTTGGTATGAGCCCCACCTTCCCCACCCCCAATTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI10748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28094271..28094639 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]


Sequence tag IST15061G4HMR1
Sequence
NTAGACTTACATGCTTCTGAACTAGGTTGCCCCACTGAAGCCTATAACCTCATTTGTAAAACCGGGGTCGCCATACCAAC
TATGTAAAGCAGACCGGGCTACATTTGCCATCTTCGGACAGATAGGGGGATTTACCTTTCTTAGGCAACTGGGCAGGGCT
AAGTATTGTTAAAATGACAGGGTGTGGTCACATACCTTTCATCCTAGCACTCACAGGCATAGACTTTGTAAGTTTTGAAG
TCAGCCTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24548814..24805693 248
NO GENE  

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es