Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W227C03
Clone ID W227C03
Vector ROSAbetageo
Project ggtc

Sequence tag W227C03
Sequence
CTCCCCACCCACCCTCGTCCGCCTTCTCTCTCAGCCTCCGTTCGTTCACTGCAGGACCCAGGCACGAAA
Sequence Type mRNA
Unitrap ID UNI12166

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 146525823..146525890 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040250 (4933424B01Rik) NM_138757 RIKEN cDNA 4933424B01 gene Gene [Source:MGI Symbol;Acc:MGI:1918427]

 
Come back to gene ENSMUSG00000040250


For any suggestions or comments, please send an email to unitrap@crg.es