Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W269D01
Clone ID W269D01
Vector ROSAbetageo
Project ggtc

Sequence tag W269D01
Sequence
TATCATTGAAGACTCATGTGTCTTACGTGGAGTTATGATTAACAAGGATGTGACCCATCCAAGGATGCGCCGCTATATTA
AGAATCCTCGAATTGTGCTATTGGATTCTTCTTTGGAGTACAAGAAAGGAGAAAGCCAGGCGGACATCGAGATTACCCGG
GAGGAGGACTTCACGCGGATCCTGCAGATGGAGGAGGAGTACATCCATCAGCTGTGTGAGGACATCATCCAGCTGAAGCC
TGACGTGGTCATCACAGAGAAGGGCATCTCAGATTTAGCTCAGCACTACCTCATGCGGGCCAATGTCACAGCCATTCGTA
GAGTCCGGAAAACAGACAATAATCGCATTGCTAG
Sequence Type mRNA
Unitrap ID UNI12167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88115607..88117559 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001416 (Cct3) NM_009836 chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]

 
Come back to gene ENSMUSG00000001416


For any suggestions or comments, please send an email to unitrap@crg.es