Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12984B6
Clone ID IST12984B6
Vector VICTR76
Project tigm

Sequence tag IST12984B6HMF1
Sequence
CTGTGTTACTTTTTTTCCTAAGTACATCATTTAGTTTTATAACTTTGACTTTGGTTGAGTTAATTTGTTGGTGTCTTGTA
AGGATGACTTCTTTGTATGGTTAGTCTTTTGTATCCCTGACTAGCCTCAAACTTGCTAGGTAGCCATGGCTGACCTTTAA
TTCCCGATATTAATTCTCCCGAGTCCTAGGACTGCAGTGTGTGCCTCCAGGCCAACTTTGTGAGCACGGCTTGGAGCAGC
AGGAGTCACTGCANTGAATATTGCANCGATGCTTGCANCTGCTTTCCATGCTGTTA
Sequence Type genomic DNA
Unitrap ID UNI18157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11456213..11456507 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040720 (1110037F02Rik) NM_001081183 RIKEN cDNA 1110037F02 gene Gene [Source:MGI Symbol;Acc:MGI:1913435]


Sequence tag IST12984B6BBF1
Sequence
CTGTGTTACTTTTTTTCCTAAGTACATCATTTAGTTTTATAACTTTGACTTTGGTTGAGTTAATTTGTTGGTGTCTTGTA
AGGATGACTTCTTTGTATGGTTAGTCTTTTGTATCCCTGACTAGCCTCAAACTTGCTAGGTANCCNTGGCTGACCTTTAA
TTCCCGATATTAATTCTCCCGAGTCCNANGACTGCNNTGTGTGCCTCCNGGCCNACTTTGTGANCNCNGCTTGGAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040720


For any suggestions or comments, please send an email to unitrap@crg.es