Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W222D04
Clone ID W222D04
Vector ROSAbetageo
Project ggtc

Sequence tag W222D04
Sequence
GGTCCCCGCCGTGGTGGCCGTTAAACGGTCTCAGAGCGGAGCTATCGGTTGTCTGCGGCCGTAGTGAGCTTTGCTTCGTT
TCCTGAAGATGGAGGGTCCTTTGTCCGTGTTCGGGGACCGCAGCACTGGGGAGGCGGTCCGCTCCCAGAATG
Sequence Type mRNA
Unitrap ID UNI10798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13109344..13109495 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068039 (Tcp1) NM_013686 t-complex protein 1 Gene [Source:MGI Symbol;Acc:MGI:98535]

 
Come back to gene ENSMUSG00000068039


For any suggestions or comments, please send an email to unitrap@crg.es