Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15052G11
Clone ID IST15052G11
Vector VICTR80
Project tigm

Sequence tag IST15052G11BBF1
Sequence
ATTGGAATTTTGAAAGTCACCTCTACACCCCCTCCCGCAGGCCCGCCCCACCCCCATCCCAGGAACAGCCTCAGTCACTC
CAAAGTAAAAACACATTGCCAATGTAGCTGTTTCAGCTTGGAGAGTATTACCTCCATATGGGCTGTGGATGGCCTAGATT
CCCTCTAGAACTCAACAGATTCTTGTTTTGCTATGGTTTTTCAGTCTTTATGTTTTGCTAACATTTTAATCCAGGATACC
AGGTCTAAAACTTTATGGTAAAGAAACAAGAGTTTCCAACCTTGAATTGGGACCTGGTCACACGTCCAGTACTTCTGATA
TTTTGGAGTCGGAGGCAGGAGAATCAGTTTCAGGCCTTCCTGAAGTGCATGAGACCCTATCTCAAAAGATTGCCTAGCTT
TGTTCAACATCTAAAAAACGAATCCTGTAAGANGCGATGGTTN
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66546055..66546496 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST15052G11HMR1
Sequence
CTGGTGCCCTCTTCTGGCATGCAGGCATATAGGCAGCAGATAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 61341716..61341757 42
NO GENE  

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es