Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11635G3
Clone ID IST11635G3
Vector VICTR76
Project tigm

Sequence tag IST11635G3HMR1
Sequence
NTTTGTGGGCCGGGGACAGCCAGCCNCCGTCCGGACCGGAGGACAGGTGCCCGCCCGGCTGGGGAGGCGGCCTAAGCCAC
AGCAGCAGCGGTCGCCATCTTGGTCCGAGACCCGCCGAACTTAGGAAATTAGTCTGAACAGGTGAGAGGGTGCGCCAGAN
AACCTGACAGCCTCTGGAACAGGCAGAAGCACAGAGGGGCTGAGGCAGCACCCTGTGTGGGCCGGGGACAGCCGGCCACC
TTCCGGACCGGAGGACAGGTGCCCGCCCGGCTGGGGAGGCNNCCTNNNCCN
Sequence Type genomic DNA
Unitrap ID UNI4546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27621241..27621524 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71819058..71819341 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 52432128..52432411 276
NO GENE  

 
Come back to gene ENSMUSG00000032228


For any suggestions or comments, please send an email to unitrap@crg.es