Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0031
Clone ID CA0031
Vector pGT0lxf*
Project sanger

Sequence tag CA0031
Sequence
GTTTTTCATTTAGAGATTCTGTCCCAAAGGACTGAGGTGGAGAGAGAGAGTGGAGGTTACCCAGTGCCCTCCTCTGACTT
ACGAGTTCTCTGAGGACAGGATACGTGAGCATACGCTACAGATAGAAAGTGTGTGTGTGAGAGAGAGAGAGAGTCTGTGA
TACTCCGGACAAGTGTTTGGTGTCACTTTGGGTACAAGATGAATGTACTGAAAGAGCACGTGGATGACGACCCCACCCTG
GCCATCACCGGGGTCCCTGTGGTCAGCTGGCCAAAGAAAACTGCAAAG
Sequence Type mRNA
Unitrap ID UNI1820

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123371394..123372114 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es