Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14371H3
Clone ID IST14371H3
Vector VICTR74
Project tigm

Sequence tag IST14371H3BBF1
Sequence
TTTGGAAAAGAGGCACCAGCTACTCAAGGCCGGATCAACAGAAGTGGGCAGTAAAACAGTCACATGGTAAACTGCACGTG
CCAGAATAAGGCTGGGCTCTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20612798..20612903 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST14371H3HMR1
Sequence
CAGAAAAACCNGGTCCAGGAACACACCACACANCACACAGATCAGGAAAGACACTTTATACTGCTGCGCCAGCACCCTCC
ANNTGTAAAACCATCAGGAACACGGTATCAATGTGCAATGAACATGCAACTTTGTCTGAGTCAGTTCAGTACACTCATCT
CACACAGACCATTCAAATTGCCATCTACCTGGACTTGGACCTGCACCTTAAATCAGCTCTGACTTGAAGAGGCTCTGCCC
ACTGCCATCCCAAAACCTTTGCCCAGCTTCCTTGATGCCTTACCTAATGACCTGCCTTAGTCTCTTGGTGTCTATACCAG
CTCTCTGGTCCTGCCCTCTGCAGCCTCTTTAATCCTTCCCTTGTCATTTANCATCCTGCATCTTCNTACATGCATGATCT
TTANAGTTAANATTGAAATANACTGCNAAATAACCNNTCTATCNNGCAAAATCNAAAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 13027762..13028219 427
 
EST/CDNA Est Name
  BY715608.1 - BY714456.1 - BU937734.1

 
Come back to gene BY715608.1 - BY714456.1 - BU937734.1


For any suggestions or comments, please send an email to unitrap@crg.es