Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W244B06
Clone ID W244B06
Vector ROSAbetageo
Project ggtc

Sequence tag W244B06
Sequence
CGGAGACTTTGGAAGCACCATGGATGGGTTTTGTGATCAGCAAGTCCCTTTTATGGTCCCAGGGAAATCTCGATCAGAGG
ACTGTGGAGCGGTCCGTTTGATTGACAGAAAGAGGAAGTTTGTGGACACAGATCTGGCTCACGATTCTGAAGAGTTGTTT
CAGGATCTTAGCCAGCTGCAGGAGGCTTGGTTAGCTGAAGCACAAGTTCCTGATGATGAGCAGTTTGTCCCAGATTTTCA
GTCGGAGGGCTGGG
Sequence Type mRNA
Unitrap ID UNI10400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22436083..22436574 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es